PortEco logo

yfbO:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

yfbO

Mnemonic

Systematic nomenclature

Synonyms

ECK2268, b2274, JW2269[1], JW2269

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

51.44 minutes 

MG1655: 2386603..2387079


BW2952

NC_012759: 2272408..2272884


W3110

 

W3110: 2393251..2393727


DH10B

DH10B: 2478368..2478844


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyfbO (Keio:JW2269)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC9828[3]

zfb-223::Tn10

Insertion at 2,387,024 bp in MG1655 (NC_000913)

adapted from Nichols et al.[4]

CAG18484 = CGSC7406[3]

Synonyms: zej-223::Tn10

ΔyfbO756::kan

PMID:16738554[2]

CGSC:104654


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2269

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCAATTCAAACAATGTCATTCG

Primer 2:CCATCCCACCAACAAGTAACCGG

9F11

Kohara Phage

Genobase

PMID:3038334[6]

4C8

Kohara Phage

Genobase

PMID:3038334[6]

E9B9

Kohara Phage

Genobase

PMID:3038334[6]

zfa-723::Tn10

Linked marker

CAG12178 gyrA+ = CGSC7526[3]

est. P1 cotransduction: 15% [4]
Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[3]

est. P1 cotransduction: % [4]
Synonyms:zfb-1::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7181

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14099

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003757

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946752

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3852

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007518

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
  4. 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories