PortEco logo

yghW:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

yghW

Gene Synonym(s)

ECK2992, b2998, JW2966[1], JW2966

Product Desc.

predicted protein[2][3]

Function unknown[4]

Product Synonyms(s)

predicted protein[1], B2998[2][1], YghW[2][1] , ECK2992, JW2966, b2998

Function from GO
Knock-Out Phenotype
Regulation/Expression

transcription unit(s): yghW[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]





Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

yghW

Mnemonic

Systematic nomenclature

Synonyms

ECK2992, b2998, JW2966[1], JW2966

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

67.77 minutes 

MG1655: 3144759..3144472


REL606

NC_012967: 3080906..3080619


BW2952

NC_012759: 3031620..3031907


W3110

 

W3110: 3145393..3145106


DH10B

DH10B: 3242504..3242217


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyghW (Keio:JW2966)

deletion

deletion

PMID:16738554

Shigen
CGSC10281[5]

ΔyghW771::kan

PMID:16738554

CGSC:105036


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2966

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAATAACCATTTTGGTAAAGG

Primer 2:CCATTTTCGAGGCGATAACCGGC

5C10

Kohara Phage

Genobase

PMID:3038334

nupG511::Tn10

Linked marker

CAG18472 = CGSC7433[5]

est. P1 cotransduction: 18% [6]

metC162::Tn10

Linked marker

CAG18475 = CGSC7435[5]

est. P1 cotransduction: 82% [6]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7555

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13007

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004115

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947485

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2829

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009839

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

YghW

Synonyms

predicted protein[1], B2998[2][1], YghW[2][1] , ECK2992, JW2966, b2998

Product description

predicted protein[2][3]

Function unknown[4]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MNNHFGKGLM AGLKATHADS AVNVTKFCAD YKRGFVLGYS HRMYEKTGDR QLSAWEAGIL
TRRYGLDKEM VMDFFRENNS CSTLRFFMAG YRLEN
Length

95

Mol. Wt

10.945 kDa

pI

9.5 (calculated)

Extinction coefficient

12,950 - 13,200 (calc based on 5 Y, 1 W, and 2 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

1..95

PF11115 Protein of unknown function (DUF2623)

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16130898

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:947485

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009839

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P64574

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G7555

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13007

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:947485

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004115

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2829

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

61

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

33

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

28a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

yghW

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2998 (EcoliWiki Page)

NCBI GEO profiles for yghW

microarray

GenExpDB:b2998 (EcoliWiki Page)

Summary of data for yghW from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

Notes

Accessions Related to yghW Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7555

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2829

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2998

EcoGene

EcoGene:EG13007

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004115

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009839

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

S3246

From SHIGELLACYC

E. coli O157

Z4352

From ECOO157CYC

Notes

Families

[back to top]


See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database Accession Notes

Pfam (EcoliWiki Page)

PF11115 Protein of unknown function (DUF2623)


Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]